Nameaae-bantam-3p
AccessionMIMAT0014219
SpeciesAedes aegypti
Precursorsaae-bantam
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
UGAGAUCAUUUUGAAAGCUGAU

Seed family [0]

Seed family - other species [41]

Landgraf expression levels [0]

M2d disease links [0]