Nameaae-let-7
AccessionMIMAT0014299
SpeciesAedes aegypti
Precursorsaae-let-7
Descriptionexperimental
Experiment454 (Li S 2009)
Sequence
UGAGGUAGUUGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Landgraf expression levels [0]

M2d disease links [0]