Nameaae-miR-10
AccessionMIMAT0014277
SpeciesAedes aegypti
Precursorsaae-mir-10
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
ACCCUGUAGAUCCGAAUUUGUU

Seed family [1]

Seed family - other species [21]

Landgraf expression levels [0]

M2d disease links [0]