Nameaae-miR-11
AccessionMIMAT0014242
SpeciesAedes aegypti
Precursorsaae-mir-11
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
CAUCACAGUCUGAGUUCUUGCU

Seed family - other species [174]

Landgraf expression levels [0]

M2d disease links [0]