Nameaae-miR-11*
AccessionMIMAT0014241
SpeciesAedes aegypti
Precursorsaae-mir-11
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
AGAACUCCGGCUGUGACCUGUG

Seed family [0]

Seed family - other species [0]

Landgraf expression levels [0]

M2d disease links [0]