Nameaae-miR-1175
AccessionMIMAT0014264
SpeciesAedes aegypti
Precursorsaae-mir-1175
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
AAGUGGAGUAGUGGUCUCAUCG

Seed family [0]

Seed family - other species [5]

Landgraf expression levels [0]

M2d disease links [0]