Nameaae-miR-1175*
AccessionMIMAT0015371
SpeciesAedes aegypti
Precursorsaae-mir-1175
Descriptionexperimental
Experiment454 (Li S 2009)
Sequence
UGAGAUUCUACUUCUCCGACUUAA

Seed family [0]

Seed family - other species [14]

Landgraf expression levels [0]

M2d disease links [0]