Nameaae-miR-12
AccessionMIMAT0014253
SpeciesAedes aegypti
Precursorsaae-mir-12
Descriptionexperimental
Experiment454 (Li S 2009), Solexa (Skalsky RL 2010)
Sequence
UGAGUAUUACAUCAGGUACUGGU

Seed family [0]

Seed family - other species [39]

Landgraf expression levels [0]

M2d disease links [0]