Nameaae-miR-12*
AccessionMIMAT0014254
SpeciesAedes aegypti
Precursorsaae-mir-12
Descriptionexperimental
ExperimentSolexa (Skalsky RL 2010)
Sequence
CAGUACUUAUGUUAUGCUCUCU

Seed family [1]

Seed family - other species [2]

Landgraf expression levels [0]

M2d disease links [0]