Nameaga-let-7
AccessionMIMAT0001495
SpeciesAnopheles gambiae
Precursorsaga-let-7
Descriptionexperimental
Experimentcloned (Winter F 2007)
Sequence
UGAGGUAGUUGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]