Nameame-let-7
AccessionMIMAT0004418
SpeciesApis mellifera
Precursorsame-let-7
Descriptionexperimental
Experimentarray (Weaver DB 2007)
Sequence
UGAGGUAGUAGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]