Nameapi-let-7
AccessionMIMAT0014709
SpeciesAcyrthosiphon pisum
Precursorsapi-let-7
Descriptionexperimental
ExperimentSolexa (Legeai F 2010)
Sequence
UGAGGUAGUUGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]