Namebfl-let-7a
AccessionMIMAT0009462
SpeciesBranchiostoma floridae
Precursorsbfl-let-7a-2, bfl-let-7a-1
Descriptionexperimental
Experiment454 (Wheeler BM 2009)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]