Namebma-let-7
AccessionMIMAT0014094
SpeciesBrugia malayi
Precursorsbma-let-7
Descriptionexperimental
ExperimentNorthern (Poole CB 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]