Namebmo-let-7
AccessionMIMAT0004190
SpeciesBombyx mori
Precursorsbmo-let-7
Descriptionexperimental
ExperimentNorthern (Tong CZ 2006, Liu S 2007, He PA 2008), RT-PCR (Cao J 2008), Solexa (Liu S 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [5]

Landgraf expression levels [0]

M2d disease links [0]