Namebta-let-7a
AccessionMIMAT0003844
SpeciesBos taurus
Precursorsbta-let-7a-1, bta-let-7a-2, bta-let-7a-3
Descriptionexperimental
Experimentcloned (Coutinho LL 2007, Gu Z 2007)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]