Namebta-let-7b
AccessionMIMAT0004331
SpeciesBos taurus
Precursorsbta-let-7b
Descriptionexperimental
Experimentcloned (Gu Z 2007, Jin W 2009)
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]