Namebta-let-7c
AccessionMIMAT0004332
SpeciesBos taurus
Precursorsbta-let-7c
Descriptionexperimental
Experimentcloned (Gu Z 2007)
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]