Namebta-let-7e
AccessionMIMAT0004333
SpeciesBos taurus
Precursorsbta-let-7e
Descriptionexperimental
Experimentcloned (Gu Z 2007)
Sequence
UGAGGUAGGAGGUUGUAUAGU

Seed family - other species [213]

Landgraf expression levels [0]

M2d disease links [0]