Namebta-let-7f
AccessionMIMAT0003519
SpeciesBos taurus
Precursorsbta-let-7f-2, bta-let-7f-1
Descriptionexperimental
Experimentcloned (Coutinho LL 2007, Gu Z 2007, Long JE 2009)
Sequence
UGAGGUAGUAGAUUGUAUAGUU

Seed family - other species [213]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]