Namebta-let-7g
AccessionMIMAT0003838
SpeciesBos taurus
Precursorsbta-let-7g
Descriptionexperimental
Experimentcloned (Coutinho LL 2007, Long JE 2009)
Sequence
UGAGGUAGUAGUUUGUACAGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]