Namebta-miR-98
AccessionMIMAT0003809
SpeciesBos taurus
Precursorsbta-mir-98
Descriptionexperimental
Experimentcloned (Coutinho LL 2007), Array (Tesfaye D 2009), qRT-PCR (Tesfaye D 2009)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [213]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]