Namecbr-let-7
AccessionMIMAT0000463
SpeciesCaenorhabditis briggsae
Precursorscbr-let-7
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family [4]

Seed family - other species [218]

Papers [2]

Landgraf expression levels [0]

M2d disease links [0]