Namecbr-miR-241
AccessionMIMAT0000501
SpeciesCaenorhabditis briggsae
Precursorscbr-mir-241
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGGUGUGAGAAAUGA

Seed family [4]

Seed family - other species [218]

Landgraf expression levels [0]

M2d disease links [0]