Namecbr-miR-48
AccessionMIMAT0000473
SpeciesCaenorhabditis briggsae
Precursorscbr-mir-48
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGGCUCAGUAGAUGCGA

Seed family [4]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]