Namecbr-miR-84
AccessionMIMAT0001311
SpeciesCaenorhabditis briggsae
Precursorscbr-mir-84
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUUGCAAUGCUGUC

Seed family [4]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]