Namecel-let-7
AccessionMIMAT0000001
SpeciesCaenorhabditis elegans
Precursorscel-let-7
Descriptionexperimental
Experimentcloned (Lau NC 2001, Lim LP 2003, Ambros V 2003, Ruby JG 2006), Northern (Lau NC 2001), PCR (Grad Y 2003), Solexa (Kato M 2009), CLIPseq (Zisoulis DG 2010)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [217]

Papers [7]

Landgraf expression levels [0]

M2d disease links [0]