Namecel-miR-241
AccessionMIMAT0000297
SpeciesCaenorhabditis elegans
Precursorscel-mir-241
Descriptionexperimental
Experimentcloned (Lim LP 2003, Ruby JG 2006), Northern (Lim LP 2003), Solexa (Kato M 2009, Warf MB 2011), CLIPseq (Zisoulis DG 2010)
Sequence
UGAGGUAGGUGCGAGAAAUGA

Seed family - other species [217]

Papers [5]

Landgraf expression levels [0]

M2d disease links [0]