Namecel-miR-48
AccessionMIMAT0000019
SpeciesCaenorhabditis elegans
Precursorscel-mir-48
Descriptionexperimental
Experimentcloned (Lau NC 2001, Lim LP 2003, Ambros V 2003, Ruby JG 2006), Solexa (Kato M 2009), CLIPseq (Zisoulis DG 2010)
Sequence
UGAGGUAGGCUCAGUAGAUGCGA

Seed family - other species [217]

Papers [6]

Landgraf expression levels [0]

M2d disease links [0]