Namecel-miR-795
AccessionMIMAT0004230
SpeciesCaenorhabditis elegans
Precursorscel-mir-795
Descriptionexperimental
Experimentcloned (Ruby JG 2006), Solexa (Kato M 2009, Warf MB 2011), CLIPseq (Zisoulis DG 2010)
Sequence
UGAGGUAGAUUGAUCAGCGAGCUU

Seed family - other species [217]

Papers [4]

Landgraf expression levels [0]

M2d disease links [0]