Namecfa-let-7a
AccessionMIMAT0006594
SpeciesCanis familiaris
Precursorscfa-let-7a-1, cfa-let-7a-2
Descriptionexperimental
ExperimentSolexa (Friedlander MR 2008)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [214]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]