Namecfa-let-7b
AccessionMIMAT0009836
SpeciesCanis familiaris
Precursorscfa-let-7b
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUGUGGUU

Seed family - other species [214]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]