Namecfa-miR-98
AccessionMIMAT0006756
SpeciesCanis familiaris
Precursorscfa-mir-98
Descriptionexperimental
ExperimentSolexa (Friedlander MR 2008)
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [214]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]