Namecin-let-7a
AccessionMIMAT0006086
SpeciesCiona intestinalis
Precursorscin-let-7a-1, cin-let-7a-2
Descriptionexperimental
ExperimentSolexa (Hendrix D 2010)
Sequence
UGAGGUAGUAGGUUAUGCAGU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]