Namecin-let-7c
AccessionMIMAT0006088
SpeciesCiona intestinalis
Precursorscin-let-7c
Descriptionexperimental
ExperimentSolexa (Hendrix D 2010)
Sequence
UGAGGUAGUAGGUUAUAUCAGU

Seed family - other species [216]

Landgraf expression levels [0]

M2d disease links [0]