Namecin-let-7d
AccessionMIMAT0006089
SpeciesCiona intestinalis
Precursorscin-let-7d
Descriptionexperimental
ExperimentNorthern (Norden-Krichmar TM 2007), Solexa (Hendrix D 2010)
Sequence
UGAGGUAGUUGGUUGUAUUGUU

Seed family - other species [216]

Papers [3]

Landgraf expression levels [0]

M2d disease links [0]