Namecin-let-7e
AccessionMIMAT0006090
SpeciesCiona intestinalis
Precursorscin-let-7e
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUGGUUGUAUCGGU

Seed family - other species [216]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]