Namecqu-let-7
AccessionMIMAT0014366
SpeciesCulex quinquefasciatus
Precursorscqu-let-7
Descriptionexperimental
ExperimentSolexa (Skalsky RL 2010)
Sequence
UGAGGUAGUUGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]