Namecrm-miR-241
AccessionMIMAT0011612
SpeciesCaenorhabditis remanei
Precursorscrm-mir-241
Descriptionexperimental
Experiment454 (de Wit E 2009)
Sequence
AGAGGUAGGUGCGAGAAAUG

Seed family [3]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]