Namecsa-let-7a
AccessionMIMAT0006116
SpeciesCiona savignyi
Precursorscsa-let-7a
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUAUAUCAGU

Seed family [3]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]