Namecsa-let-7b
AccessionMIMAT0006117
SpeciesCiona savignyi
Precursorscsa-let-7b
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUAUGUUGUU

Seed family [3]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]