Namecsa-let-7d
AccessionMIMAT0006119
SpeciesCiona savignyi
Precursorscsa-let-7d
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUGGUUGUAUUGUU

Seed family [3]

Seed family - other species [218]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]