Namedme-let-7-5p
AccessionMIMAT0000396
SpeciesDrosophila melanogaster
Precursorsdme-let-7
Descriptionexperimental
Experimentcloned (Aravin AA 2003), Northern (Aravin AA 2003, Lagos-Quintana M 2001, Sempere LF 2003), 454 (Ruby JG 2007, Stark A 2007), Solexa (Stark A 2007)
Sequence
UGAGGUAGUAGGUUGUAUAGU

Seed family [1]

Seed family - other species [221]

Papers [5]

Landgraf expression levels [0]

M2d disease links [0]