Namedpe-let-7
AccessionMIMAT0008699
SpeciesDrosophila persimilis
Precursorsdpe-let-7-1, dpe-let-7-2
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUAGU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]