Namedre-let-7a
AccessionMIMAT0001759
SpeciesDanio rerio
Precursorsdre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6
Descriptionexperimental
Experimentcloned (Chen PY 2005)
Sequence
UGAGGUAGUAGGUUGUAUAGUU

Seed family - other species [212]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]