Namedre-let-7d
AccessionMIMAT0001762
SpeciesDanio rerio
Precursorsdre-let-7d-1, dre-let-7d-2
Descriptionexperimental
Experimentcloned (Chen PY 2005)
Sequence
UGAGGUAGUUGGUUGUAUGGUU

Seed family - other species [212]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]