Namedre-let-7j
AccessionMIMAT0003015
SpeciesDanio rerio
Precursorsdre-let-7j
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUUGUUUGUACAGUU

Seed family - other species [212]

Landgraf expression levels [0]

M2d disease links [0]