Nameeca-let-7c
AccessionMIMAT0013181
SpeciesEquus caballus
Precursorseca-let-7c
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAGGUUGUAUGGUU

Seed family - other species [215]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]