Nameeca-miR-98
AccessionMIMAT0013247
SpeciesEquus caballus
Precursorseca-mir-98
Descriptionnot_experimental
Experiment
Sequence
UGAGGUAGUAAGUUGUAUUGUU

Seed family - other species [215]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]