Nameegr-let-7
AccessionMIMAT0020227
SpeciesEchinococcus granulosus
Precursorsegr-let-7
Descriptionexperimental
Experimentcloned (Cucher M 2011)
Sequence
UGAGGUAGUGUUUCGAAUGUCU

Seed family [0]

Seed family - other species [221]

Papers [1]

Landgraf expression levels [0]

M2d disease links [0]